Review



lumino graph 2  (ATTO Corp)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    ATTO Corp lumino graph 2
    Lumino Graph 2, supplied by ATTO Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lumino+graph+2/lumino+graph+2/pm36572562-128-21-24
    Average 90 stars, based on 1 article reviews
    lumino graph 2 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: The role of KiSS1 gene on the growth and migration of prostate cancer and the underlying molecular mechanisms.
    Article Snippet: Metastatic prostate cancers have a high mortality rate.. KiSS1 was originally identified as a metastasis suppressor gene in metastatic melanoma and breast cancer, but its role in prostate cancer has been contradictory.. This study was therefore undertaken to investigate the effects of KiSS1 overexpression on the growth and migration of human metastatic prostate cancer cells.

    Article Title: Overexpression of KiSS1 Induces the Proliferation of Hepatocarcinoma and Increases Metastatic Potential by Increasing Migratory Ability and Angiogenic Capacity.
    Article Snippet: .. To visualize the amplified KiSS1 genes, qPCR products were separated in a 1.5% agarose gel and the gel was scanned using Lumino Graph 2 (ATTO Corporation, Japan). .. Automated capillary-based western immunoblot Total proteins of the cells were isolated by using radio immunoprecipitation assay (RIPA) buffer (ATTO Corporation), and the protein concentration was measured using bicinchoninic acid (Sigma-Aldrich) assay.

    Polymerase Chain Reaction:

    Article Title: The role of KiSS1 gene on the growth and migration of prostate cancer and the underlying molecular mechanisms.
    Article Snippet: Metastatic prostate cancers have a high mortality rate.. KiSS1 was originally identified as a metastasis suppressor gene in metastatic melanoma and breast cancer, but its role in prostate cancer has been contradictory.. This study was therefore undertaken to investigate the effects of KiSS1 overexpression on the growth and migration of human metastatic prostate cancer cells.

    Article Title: The role of KiSS1 gene on the tumor growth and migration of prostate cancer and the underlying molecular mechanisms
    Article Snippet: .. Page 10/32 Primer Sequences (5'→3') BMP7 Forward: CATCCTAACCAAGTGTCCCG Reverse: ACATGGCCACAGTTTTCGAT SNAI2 Forward: GCGATGCCCAGTCTAGAAAA Reverse: CATGCAAATCCAACAGCCAG CDH1 Forward: TGACAACAAGCCCGAATTCA Reverse: TGACCACACTGATGACTCCT CDH2 Forward: TGGATGAAGATGGCATGGTG Reverse: TCTGCTGACTCCTTCACTGA VEGF-A Forward: CCTAACCCCAGCCTTTGTTT Reverse: CAGCGTGGTTTCTGTATCGA PECAM-1 Forward: CTGACCATCTGCTCTCACAC Reverse: TTCTGTCTCTGAGCCACTGA To visualize the ampli ed KiSS1 genes, PCR products in which the KiSS1 gene was ampli ed were separated in a 1.5% agarose gel and the gels were scanned using Lumino Graph 2 (ATTO Corporation, Tokyo, Japan). .. Automated capillary-based western immunoblot The proteins were extracted using radio immunoprecipitation assay (RIPA) buffer (ATTO corporation) from the cells.

    Agarose Gel Electrophoresis:

    Article Title: The role of KiSS1 gene on the growth and migration of prostate cancer and the underlying molecular mechanisms.
    Article Snippet: Metastatic prostate cancers have a high mortality rate.. KiSS1 was originally identified as a metastasis suppressor gene in metastatic melanoma and breast cancer, but its role in prostate cancer has been contradictory.. This study was therefore undertaken to investigate the effects of KiSS1 overexpression on the growth and migration of human metastatic prostate cancer cells.

    Article Title: Overexpression of KiSS1 Induces the Proliferation of Hepatocarcinoma and Increases Metastatic Potential by Increasing Migratory Ability and Angiogenic Capacity.
    Article Snippet: .. To visualize the amplified KiSS1 genes, qPCR products were separated in a 1.5% agarose gel and the gel was scanned using Lumino Graph 2 (ATTO Corporation, Japan). .. Automated capillary-based western immunoblot Total proteins of the cells were isolated by using radio immunoprecipitation assay (RIPA) buffer (ATTO Corporation), and the protein concentration was measured using bicinchoninic acid (Sigma-Aldrich) assay.

    Article Title: The role of KiSS1 gene on the tumor growth and migration of prostate cancer and the underlying molecular mechanisms
    Article Snippet: .. Page 10/32 Primer Sequences (5'→3') BMP7 Forward: CATCCTAACCAAGTGTCCCG Reverse: ACATGGCCACAGTTTTCGAT SNAI2 Forward: GCGATGCCCAGTCTAGAAAA Reverse: CATGCAAATCCAACAGCCAG CDH1 Forward: TGACAACAAGCCCGAATTCA Reverse: TGACCACACTGATGACTCCT CDH2 Forward: TGGATGAAGATGGCATGGTG Reverse: TCTGCTGACTCCTTCACTGA VEGF-A Forward: CCTAACCCCAGCCTTTGTTT Reverse: CAGCGTGGTTTCTGTATCGA PECAM-1 Forward: CTGACCATCTGCTCTCACAC Reverse: TTCTGTCTCTGAGCCACTGA To visualize the ampli ed KiSS1 genes, PCR products in which the KiSS1 gene was ampli ed were separated in a 1.5% agarose gel and the gels were scanned using Lumino Graph 2 (ATTO Corporation, Tokyo, Japan). .. Automated capillary-based western immunoblot The proteins were extracted using radio immunoprecipitation assay (RIPA) buffer (ATTO corporation) from the cells.

    Real-time Polymerase Chain Reaction:

    Article Title: Overexpression of KiSS1 Induces the Proliferation of Hepatocarcinoma and Increases Metastatic Potential by Increasing Migratory Ability and Angiogenic Capacity.
    Article Snippet: .. To visualize the amplified KiSS1 genes, qPCR products were separated in a 1.5% agarose gel and the gel was scanned using Lumino Graph 2 (ATTO Corporation, Japan). .. Automated capillary-based western immunoblot Total proteins of the cells were isolated by using radio immunoprecipitation assay (RIPA) buffer (ATTO Corporation), and the protein concentration was measured using bicinchoninic acid (Sigma-Aldrich) assay.



    Similar Products

    lumino graph 2  (ATTO Corp)
    90
    ATTO Corp lumino graph 2
    Lumino Graph 2, supplied by ATTO Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lumino+graph+2/lumino+graph+2/pm36572562-128-21-24
    Average 90 stars, based on 1 article reviews
    lumino graph 2 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results